An Example Run ¶

Below is an example that uses the test dataset provided with NucKit. The following commands lead the user through each utility to go from unprocessed paired-end sequence data at the read level to identified genomic locations. This type of work flow has several uses in bioinformatics, including the monitoring of foreign DNA integrated into a host geneome. The sequence reads themselves represent the product of an amplification reaction to target the foreign DNA and the flanking host geneomic sequence.

conda activate nuckit
cd {path/to/nuckit}

nuckit demulti -m etc/test.sampleinfo.csv \
    --read1 etc/test_data/Undetermined_S0_L001_R1_001.fastq.gz \
    --read2 etc/test_data/Undetermined_S0_L001_R2_001.fastq.gz \
    --idx1 etc/test_data/Undetermined_S0_L001_I1_001.fastq.gz \
    --idx2 etc/test_data/Undetermined_S0_L001_I2_001.fastq.gz \
    -o etc/test_output \
    --compress

nuckit trim etc/test_output/testSeq-1.R2.fastq.gz \
    -o etc/test_output/testSeq-1.R2.trim.fastq.gz \
    -l ACATATGACAACTCAATTAAACGCGAGC --leadMismatch 3 \
    -r AGATCGGAAGAGCGTCGTGT --overMismatch 4 --overMaxLength 20 \
    --compress

nuckit trim etc/test_output/testSeq-1.R1.fastq.gz \
    -o etc/test_output/testSeq-1.R1.trim.fastq.gz \
    -r GCTCGCGTTTAATTGAGTTGTCATATGT --overMismatch 4 --overMaxLength 20 \
    --compress

nuckit filt etc/test_output/testSeq-1.R2.trim.fastq.gz etc/test_output/testSeq-1.R1.trim.fastq.gz \
    -o etc/test_output/testSeq-1.R2.filt.fastq etc/test_output/testSeq-1.R1.filt.fastq \
    --compress

nuckit consol etc/test_output/testSeq-1.R2.filt.fastq.gz \
    -o etc/test_output/testSeq-1.R2.consol.fasta \
    -k etc/test_output/testSeq-1.R2.key.csv \
    -l testSeq1. \
    --compress

nuckit consol etc/test_output/testSeq-1.R1.filt.fastq.gz \
    -o etc/test_output/testSeq-1.R1.consol.fasta \
    -k etc/test_output/testSeq-1.R1.key.csv \
    -l testSeq1. \
    --compress

# Make sure you have 'blat' installed and a 2bit copy of the hg38 reference genome.
blat hg38.2bit etc/test_output/testSeq-1.R2.consol.fasta etc/test_output/testSeq-1.R2.psl \
    -tileSize=11 -stepSize=9 -minIdentity=85 -maxIntron=5 \
    -minScore=27 -dots=1000 -out=psl -noHead

gzip etc/test_output/testSeq-1.R2.psl

blat hg38.2bit etc/test_output/testSeq-1.R1.consol.fasta etc/test_output/testSeq-1.R1.psl\
    -tileSize=11 -stepSize=9 -minIdentity=85 -maxIntron=5 \
    -minScore=27 -dots=1000 -out=psl -noHead

gzip etc/test_output/testSeq-1.R1.psl

nuckit couple etc/test_data/testSeq-1.R2.psl.gz etc/test_data/testSeq-1.R1.psl.gz \
    -k etc/test_output/testSeq-1.R2.key.csv etc/test_output/testSeq-1.R1.key.csv \
    -o etc/test_output/testSeq-1.uniq.csv \
    --condSites etc/test_output/testSeq-1.cond.csv \
    --chimera etc/test_output/testSeq-1.chimera.rds \
    --multihit etc/test_output/testSeq-1.multihit.rds \
    --refGenome hg38

conda deactivate

An Example Run¶

An Example Run ¶